circad | circRNAs associated with diseases

circular RNA100783/hsa_circ_0008887
Gene	HIPK3	Organism	Human
Genome Locus	chr11:33307958-33350179:+	Build	hg19
Disease	Immunosenescence	ICD-10	Other immunodeficiencies (D84)
DBLink	Link to database	PMID	26451160
Experimental Method
Sample Type	Peripheral Blood Mononuclear Cells (PBMCs)	Comparison	21 apparently healthy elderly individuals and 8 healthy adult volunteers
Method for Estimation	Quantitative PCR and Microarrays	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward CCATTTTGTGAAGCCATAGAC Reverse CACATAGGTCCGTGGATAGTTT	Statistics	Fold Change : Upregulated pvalue : p<0.001
Citation
Wang, YH, Yu, XH, Luo, SS, Han, H (2015). Comprehensive circular RNA profiling reveals that circular RNA100783 is involved in chronic CD28-associated CD8(+)T cell ageing. Immun Ageing, 12:17.